si:dkey-203o21.1

Ensembl ID:
ENSDARG00000092038
ZFIN ID:
ZDB-GENE-070705-361
Description:
Novel protein similar to vertebrate GREB1 protein (GREB1) [Source:UniProtKB/TrEMBL;Acc:A5WW55]
Human Orthologue:
GREB1L
Human Description:
growth regulation by estrogen in breast cancer-like [Source:HGNC Symbol;Acc:31042]
Mouse Orthologue:
Greb1l
Mouse Description:
growth regulation by estrogen in breast cancer-like Gene [Source:MGI Symbol;Acc:MGI:3576497]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17608 Nonsense Available for shipment Available now
sa1657 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147244 Nonsense 41 309 1 6

The following transcripts of ENSDARG00000092038 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 11555600)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11980696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTAAGGTCAAGCGGTGGTGACCCACAGCCGGTTTTCACACAGCTATA[T/A]CTCKAGCCTGATCAGTATTCTGGCCATGTAGAAGGTAAGCAAGGCTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147244 Nonsense 43 309 1 6

The following transcripts of ENSDARG00000092038 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 11555604)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11980700
KASP Assay ID:
554-1604.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGGTCAAGCGGTGGTGACCCACAGCCGGTTTTCACACAGCTATATCTC[G/T]AGCCTGATCAGTATTCTGGCCATGTAGAAGGTAAGCAAGGCTATTTGTCNNNNNNNNC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link