si:ch211-156j16.1

Ensembl ID:
ENSDARG00000092035
ZFIN ID:
ZDB-GENE-030131-4106
Description:
hypothetical protein LOC564557 [Source:RefSeq peptide;Acc:NP_001119889]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1208 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1208
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134987 Nonsense 48 171 2 4
ENSDART00000138835 Nonsense 48 186 2 4
Genomic Location (Zv9):
Chromosome 8 (position 27683963)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26811881
KASP Assay ID:
554-1117.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAACGACTTCAGAACCAAAACCTTCAGAAACATCTCCTCCAGTAGCAT[C/A]AACACAAACACCAGTTTCTGAAACTACAGAAAAAATGCCTGTCATGACTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link