si:dkey-20i20.9

Ensembl ID:
ENSDARG00000092027
ZFIN ID:
ZDB-GENE-060503-152
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPU8]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32366 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134028 Nonsense 158 224 3 3
Genomic Location (Zv9):
Chromosome 22 (position 2024920)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2766010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGAAACCTTACCAGTGTTCACACTGCGACAAGAGATTCAGTTTTTTA[C/T]AAAACCTGAAAGCACACGAGAGGACTCACACTGGAGAGAAACCTTACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link