si:dkey-181c1.7

Ensembl ID:
ENSDARG00000092008
ZFIN ID:
ZDB-GENE-100922-158
Human Orthologue:
PEAR1
Human Description:
platelet endothelial aggregation receptor 1 [Source:HGNC Symbol;Acc:33631]
Mouse Orthologue:
Pear1
Mouse Description:
platelet endothelial aggregation receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1920432]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2863 Nonsense F2 line generated During 2017
sa36172 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42751 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2863
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135981 Nonsense 8 235 1 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 32801506)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30540021
KASP Assay ID:
554-3072.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAATTCTGTCCCTGTATATGTTGCTCCAGCTGTCACCCTCTGAAGGGC[G/T]AGTGCACCTGTCAGCCAGGCTGGGCTGGTCTGTACTGTAATGAAACCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135981 Essential Splice Site 99 235 2 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 32801897)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30540412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTCTATAGTCTGTTCTCCTGTGGATGGAGCGTGTATCTGTAAGGAAG[G/A]TGAGTTTTGGTACACTTATTAGCTAAAATAATGTACAAACTACTTGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135981 Nonsense 174 235 4 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 32805145)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30543660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGACCAGGCTGTCAAAACCAATGTGACTGTGTGCATGATGAGGGATG[T/A]GAGAGTGTTACAGGACAGTGTCTGTGTTTACCAGGCTGGACAGGTAAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link