si:ch211-135f11.4

Ensembl ID:
ENSDARG00000091969
ZFIN ID:
ZDB-GENE-060531-15
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CED0]
Mouse Orthologue:
Abo
Mouse Description:
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20401 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138468 Nonsense 200 275 2 2
Genomic Location (Zv9):
Chromosome 5 (position 25544001)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23371266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTATTATGGTGGAGCTGTGCTTGGTGGTTCAGTGAAGTGCGTATAT[C/T]AGCTCGCTAAAACCTGTCGAGAGCAGCTGGACATTGATGCAGCTAAATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link