LOC100331138

Ensembl ID:
ENSDARG00000091962
Human Orthologue:
RUNDC1
Human Description:
RUN domain containing 1 [Source:HGNC Symbol;Acc:25418]
Mouse Orthologue:
Rundc1
Mouse Description:
RUN domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2144506]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3435 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142959 Nonsense 457 573 6 6
ENSDART00000144937 Nonsense 456 572 7 7
Genomic Location:
Chromosome 3 (position 30054542)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCCAAAAACGGCCAGGCGTTTGTTGAATCGCCCGCTCGGCAGCTCTCA[C/T]AATCCTTCAGTTTGCCTGTAGGTGGCGGTCCTGTGACAGTCACACCCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4i09ignw