si:ch211-215e19.6

Ensembl ID:
ENSDARG00000091949
ZFIN ID:
ZDB-GENE-060503-874
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S4U8]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33050 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144934 Essential Splice Site 121 224 None 3
ENSDART00000146288 Essential Splice Site 123 170 None 3
Genomic Location (Zv9):
Chromosome 2 (position 52159258)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51524603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGGACACTAGACGCTGGTTATTATTTGTATCTGACGGTACAATCAGG[T/C]AAAGAAAACCTTTCAAAATCTCTATTATTTCTGATGAACAAATAATGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link