si:ch211-12e13.1

Ensembl ID:
ENSDARG00000091930
ZFIN ID:
ZDB-GENE-060526-24
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2ARH5]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2209 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2209
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137774 Nonsense 55 252 1 4
Genomic Location (Zv9):
Chromosome 5 (position 9612084)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8713956
KASP Assay ID:
554-2625.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCAAACACACCTGCCAGSCTCTCTTTACCTCATGACCAGATACTTTTA[T/A]CAGTCTCTCCGAAAAAAACGTGGACAAATGAGAGAAGACAAAGAAACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link