pcdh1a3

Ensembl ID:
ENSDARG00000091924
ZFIN ID:
ZDB-GENE-050202-3
Description:
protocadherin 1 alpha 3 [Source:RefSeq peptide;Acc:NP_001019268]
Human Orthologues:
PCDHA1, PCDHA10, PCDHA11, PCDHA12, PCDHA13, PCDHA2, PCDHA3, PCDHA4, PCDHA5, PCDHA6, PCDHA7, PCDHA8, PCDHA9
Human Descriptions:
protocadherin alpha 1 [Source:HGNC Symbol;Acc:8663]
protocadherin alpha 10 [Source:HGNC Symbol;Acc:8664]
protocadherin alpha 11 [Source:HGNC Symbol;Acc:8665]
protocadherin alpha 12 [Source:HGNC Symbol;Acc:8666]
protocadherin alpha 13 [Source:HGNC Symbol;Acc:8667]
protocadherin alpha 2 [Source:HGNC Symbol;Acc:8668]
protocadherin alpha 3 [Source:HGNC Symbol;Acc:8669]
protocadherin alpha 4 [Source:HGNC Symbol;Acc:8670]
protocadherin alpha 5 [Source:HGNC Symbol;Acc:8671]
protocadherin alpha 6 [Source:HGNC Symbol;Acc:8672]
protocadherin alpha 7 [Source:HGNC Symbol;Acc:8673]
protocadherin alpha 8 [Source:HGNC Symbol;Acc:8674]
protocadherin alpha 9 [Source:HGNC Symbol;Acc:8675]
Mouse Orthologue:
AC020968.2
Mouse Description:
protocadherin alpha-3 [Source:RefSeq peptide;Acc:NP_619603]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41643 Nonsense Mutation detected in F1 DNA During 2017
sa41644 Nonsense Mutation detected in F1 DNA During 2017
sa34891 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108584 Nonsense 171 787 1 4
Genomic Location (Zv9):
Chromosome 10 (position 21641415)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21602829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTCGGCAGTAATTCACTGAAAGACTACAAACTCAGTTCAAATGAATA[T/A]TTTTCATTAGATGTTCATAGCGAGCAACAAATTGTATCTGCAGAATTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108584 Nonsense 271 787 1 4
Genomic Location (Zv9):
Chromosome 10 (position 21641713)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21603127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTACCATTTCTGCCAGTGATTTGGATGAGGGCACTAATGGGCAAATT[C/T]AATATTCATTTCTTGGAAATACCGATGAACAAAACCTTTTTACAATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108584 Nonsense 362 787 1 4
Genomic Location (Zv9):
Chromosome 10 (position 21641987)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21603401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGATAGAAAGTGTGAAAGAGGACGCAAAGCCCGGAACTGCCGTAGCTT[T/A]AGTCACAGTGTCTGATAAAGATGGGGGTAAAAATGGCATTGTACAATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link