ttnb

Ensembl ID:
ENSDARG00000091908
ZFIN ID:
ZDB-GENE-030616-413
Description:
Novel protein similar to H.sapiens TTN, titin (TTN) [Source:UniProtKB/TrEMBL;Acc:B0S6Y0]
Human Orthologue:
TTN
Human Description:
titin [Source:HGNC Symbol;Acc:12403]
Mouse Orthologue:
Ttn
Mouse Description:
titin Gene [Source:MGI Symbol;Acc:MGI:98864]

Alleles

There are 18 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41523 Nonsense Mutation detected in F1 DNA During 2016
sa16157 Essential Splice Site Available for shipment Available now
sa34739 Nonsense Mutation detected in F1 DNA During 2016
sa14252 Essential Splice Site Available for shipment Available now
sa529 Nonsense Confirmed mutation in F2 line During 2016
sa11847 Nonsense Available for shipment Available now
sa17611 Nonsense Available for shipment Available now
sa41522 Nonsense Mutation detected in F1 DNA During 2016
sa15669 Nonsense Available for shipment Available now
sa41521 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16201 Essential Splice Site Available for shipment Available now
sa41520 Nonsense Mutation detected in F1 DNA During 2016
sa2520 Nonsense F2 line generated During 2016
sa9015 Nonsense Mutation detected in F1 DNA During 2016
sa21570 Nonsense Mutation detected in F1 DNA During 2016
sa41519 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7211 Nonsense Confirmed mutation in F2 line During 2016
sa34738 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 196 5618 4 53
ENSDART00000141122 Nonsense 196 5618 5 54
ENSDART00000144779   None 497 None 8
Genomic Location (Zv9):
Chromosome 9 (position 43943850)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43069020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATATTCAATTTCTATATGTTTATTGTTACTTTCTTTTCATTTCAGGT[G/T]AGGAAGTTGCAGTGCCTGCAAAGAAGACTAAGACTTTTGTTTCAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Essential Splice Site 483 5618 8 53
ENSDART00000141122 Essential Splice Site 483 5618 9 54
ENSDART00000144779   None 497 None 8
Genomic Location (Zv9):
Chromosome 9 (position 43939505)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43064675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAGTGAGGCTGGAACTATCAGCACCTCCTGCTACCTGCTYGTCAAAG[G/A]TAACAAATCATAAAATATGATTTGGCTTTAAACAAAACTATCTCTGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 686 5618 12 53
ENSDART00000141122 Nonsense 686 5618 13 54
ENSDART00000144779   None 497 None 8
Genomic Location (Zv9):
Chromosome 9 (position 43937705)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43062875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGAGATTCATCCAAGAAGTTGAGTTTCACCTACTCAAGATTACCTA[T/A]CAGGAGCTGGTGACTGAGGATGGGGAACAGCTGGATATGAGTGTTCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Essential Splice Site 889 5618 15 53
ENSDART00000141122 Essential Splice Site 889 5618 16 54
ENSDART00000144779   None 497 None 8
ENSDART00000000908 Essential Splice Site 889 5618 15 53
ENSDART00000141122 Essential Splice Site 889 5618 16 54
ENSDART00000144779   None 497 None 8
Genomic Location (Zv9):
Chromosome 9 (position 43936834)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43062004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTACAATTTTATTGCAATATAGTGGCAACTATATATATTTTTCATTTC[A/T]GGACAACAAGTGGTCAATGACTACACTCACAAGATYGTGGTMAAGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa529
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 1206 5618 17 53
ENSDART00000141122 Nonsense 1206 5618 18 54
ENSDART00000144779   None 497 None 8
Genomic Location (Zv9):
Chromosome 9 (position 43935677)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43060847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAGATGAGAAAAGCCTTGTTGAGGAAACTCAATTGCCAGAGGGAAGG[C/T]GAGGGCAAAGAATAGATGAAATAGAGCGTATTGCTCATGAGGGTGGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 1570 5618 18 53
ENSDART00000141122 Nonsense 1570 5618 19 54
ENSDART00000144779   None 497 None 8
Genomic Location (Zv9):
Chromosome 9 (position 43934500)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43059670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTRSATRGATTTCAGTCATTATTTTTTNCTTCTGTTTTTTAGGCAAA[C/T]AAGTTGTTACATTCACACAACTTTTAGAAGATCAGAGTGCTAAAGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 1849 5618 21 53
ENSDART00000141122 Nonsense 1849 5618 22 54
ENSDART00000144779   None 497 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43933247)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43058417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTAGTAATCACTTTGTTTCATACACAGCTWTTGGCTTCTTGACACCAT[T/G]AAAAGATGTATCCACTGTGGAAGGGACTAAAGCTGTCCTTGAGGCTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 1908 5618 21 53
ENSDART00000141122 Nonsense 1908 5618 22 54
ENSDART00000144779   None 497 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43933070)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43058240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGTCAAAGGATCCAAACAGAGACTGGCCATTAATCGAACTTATGCAT[C/A]AGATGAAGGACAGTATAAACTGATTGCTGGAAAAGTAGACTCAACATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 1929 5618 21 53
ENSDART00000141122 Nonsense 1929 5618 22 54
ENSDART00000144779   None 497 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43933008)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43058178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTATAAACTGATTGCTGGAAAAGTAGACTCAACATGTAAACTTTCTGTC[G/T]AGCGTGAGTATCWTTTMAAAATACTTGCMTTTCCTTAGTTTTGGTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Essential Splice Site 2103 5618 23 53
ENSDART00000141122 Essential Splice Site 2103 5618 24 54
ENSDART00000144779   None 497 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43932269)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43057439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTACCAGGTGGCAAATTCCAAGACATCTGGCAATCTGAAGGTTGAAG[G/A]TAAACTGCTTGGCCTTTGCAAAAAGATTTATCTTCCTCACTTATTAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Essential Splice Site 2192 5618 None 53
ENSDART00000141122 Essential Splice Site 2192 5618 None 54
ENSDART00000144779   None 497 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43931921)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43057091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTTTAAACTTGGAAAACTCTCTGCTAACGCCAGACTGAATGTTGAAAG[T/A]ATGTTTTAATTTATCTGTCAAATATATAGTTACATAAATTTGTTTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 2227 5618 25 53
ENSDART00000141122 Nonsense 2227 5618 26 54
ENSDART00000144779   None 497 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43931725)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43056895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATTTGAGCTCAGTTTGTCCCACGATGACATTCCAGTTAAATGGATGT[T/G]AAACAATCAGGAGCTCACAACAAGTTCAAATATTAAAATACTGTCTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2520
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 3632 5618 36 53
ENSDART00000141122 Nonsense 3632 5618 37 54
ENSDART00000144779   None 497 None 8
ENSDART00000000908 Nonsense 3632 5618 36 53
ENSDART00000141122 Nonsense 3632 5618 37 54
ENSDART00000144779   None 497 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43923879)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43049049
KASP Assay ID:
554-3282.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAGAGCTAGCAACCGTGAATTCCACTCAATGTTTGGTAGAAAAGGAA[C/T]AAACCAAACCAGTGCTTGCATCAGTCAGTGATACTAAGCACACTCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 3828 5618 36 53
ENSDART00000141122 Nonsense 3828 5618 37 54
ENSDART00000144779   None 497 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43923291)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43048461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCCAGAGACAAGAAAAAGACCGTAAATGTCTAGCAATCAAAGAAGAG[C/T]GAGTAGAACTAACTTCAGATCATRTCAAAGACCTTGATATGAWGGTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 4222 5618 36 53
ENSDART00000141122 Nonsense 4222 5618 37 54
ENSDART00000144779   None 497 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43922109)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43047279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAATCCAAAATGGAGAGCTACAGTATCATTGAAACTGAACATAAAAGT[G/T]AAATGAAATTAGGATCAGTCGAATATTTTAAGAGAGATGTGTGTGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Essential Splice Site 4566 5618 39 53
ENSDART00000141122 Essential Splice Site 4566 5618 40 54
ENSDART00000144779   None 497 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43916977)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43042147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGCCTTCGGAAGAGAAATTTGCCATGCTACTGTGACTGCAGTGACTG[G/A]TTTGTATACTAGGATTTCGGTAATGCTGTATATATTTTATTTGATGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7211
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908 Nonsense 4990 5618 44 53
ENSDART00000141122 Nonsense 4990 5618 45 54
ENSDART00000144779   None 497 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43913682)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43038852
KASP Assay ID:
554-5183.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATTGGAAAAATCTTTGTMACWTGGTACAAGGATGGCAAACAGGCCTA[T/A]GCTTCATATAGATGCAACACAAAAGTTATCGGAAACACTTGCGTTTTGGA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 4
ZFS:0000036
larval locomotory behavior
GO:0008345
disrupted
PATO:0001507
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa34738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000908   None 5618 None 53
ENSDART00000141122   None 5618 None 54
ENSDART00000144779 Nonsense 363 497 3 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 43903412)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43028582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCCTCAGACATCACCGGTAGTGATGCCAAAGGAAACTGAAACAAAGT[T/A]GAAGGAAGAGCGTAACGCACTTGAAAGAGGTAAAGATTATAATCTTCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)
  • RR interval (heart rate): A genome-wide association scan of RR and QT interval duration in 3 European genetically isolated populations: the EUROSPAN project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link