si:dkey-108f8.4

Ensembl ID:
ENSDARG00000091856
ZFIN ID:
ZDB-GENE-100922-175
Human Orthologue:
MEGF8
Human Description:
multiple EGF-like-domains 8 [Source:HGNC Symbol;Acc:3233]
Mouse Orthologue:
Megf8
Mouse Description:
multiple EGF-like-domains 8 Gene [Source:MGI Symbol;Acc:MGI:2446294]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28664 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137217 Nonsense 263 401 6 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 28679696)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26555470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCACTGGAGGACCTTGTTGTTTACAATTTTTCAACCAACAGTTGGGAA[C/T]AGATGACATTCTCGCATAGTCCAGTAAGATCCTTTATCTCTTAAAAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link