ENSDARG00000091844

Ensembl ID:
ENSDARG00000091844
Human Orthologue:
ADAMTS13
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 13 [Source:HGNC Symbol;Acc:1366]
Mouse Orthologue:
Adamts13
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13 Gene

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38214 Nonsense Mutation detected in F1 DNA During 2017
sa32563 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126385 Nonsense 300 692 6 6
Genomic Location (Zv9):
Chromosome Zv9_NA786 (position 21446)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150603.1 21446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAACAACAAGCAAACCACCATCCAAATCCAAAACAACCACCAAAGTG[C/T]GAACCACAACCACAGCACAAACCACCTTGTCAACAAGCACACCTCAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126385 Nonsense 306 692 6 6
Genomic Location (Zv9):
Chromosome Zv9_NA786 (position 21464)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150603.1 21464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCATCCAAATCCAAAACAACCACCAAAGTGCGAACCACAACCACAGCA[C/T]AAACCACCTTGTCAACAAGCACACCTCAGTTACACACAACATCAGACGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coagulation factor levels: Linkage analysis identifies a locus for plasma von Willebrand factor undetected by genome-wide association. (View Study)
  • Liver enzyme levels: Population-based genome-wide association studies reveal six loci influencing plasma levels of liver enzymes. (View Study)
  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link