ENSDARG00000091843

Ensembl ID:
ENSDARG00000091843
Human Orthologue:
UBAP1
Human Description:
ubiquitin associated protein 1 [Source:HGNC Symbol;Acc:12461]
Mouse Orthologues:
Gm514, Ubap1
Mouse Descriptions:
predicted gene 514 Gene [Source:MGI Symbol;Acc:MGI:2685360]
ubiquitin-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:2149543]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20870 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124945 Essential Splice Site 67 399 2 6
Genomic Location:
Chromosome 7 (position 14576162)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGGAAATCCCTCTTCCAGACTACCTGAAGATCCTGCAGGAAACTGAGG[T/A]CTGTGCTTGCTCTCTCTCAGCTGCATGGGTCATCTGATGCCCTCAAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rwy04b1v