SH2D1B

Ensembl ID:
ENSDARG00000091835
Description:
SH2 domain containing 1B [Source:HGNC Symbol;Acc:30416]
Human Orthologue:
SH2D1B
Human Description:
SH2 domain containing 1B [Source:HGNC Symbol;Acc:30416]
Mouse Orthologues:
Sh2d1b1, Sh2d1b2
Mouse Descriptions:
SH2 domain protein 1B1 Gene [Source:MGI Symbol;Acc:MGI:1349420]
SH2 domain protein 1B2 Gene [Source:MGI Symbol;Acc:MGI:3622649]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37900 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37900
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129745 Nonsense 91 143 3 4
Genomic Location (Zv9):
Chromosome 24 (position 25811719)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25058597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTTTCAAGAACATGAAGGATCTAATTCATCATTACAAGCAAAATAAT[C/T]AAGGACTTGCAACACGTTTACGCCATGCACTGAAAAGAAAAACACTGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link