ENSDARG00000091834

Ensembl ID:
ENSDARG00000091834
Human Orthologues:
MUC12, MUC16, MUC17, MUC20, MUC4, MUC5B
Human Descriptions:
mucin 12, cell surface associated [Source:HGNC Symbol;Acc:7510]
mucin 16, cell surface associated [Source:HGNC Symbol;Acc:15582]
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
mucin 20, cell surface associated [Source:HGNC Symbol;Acc:23282]
mucin 4, cell surface associated [Source:HGNC Symbol;Acc:7514]
mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]
Mouse Orthologues:
Muc20, Muc4
Mouse Descriptions:
mucin 20 Gene [Source:MGI Symbol;Acc:MGI:2385039]
mucin 4 Gene [Source:MGI Symbol;Acc:MGI:2153525]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33255 Nonsense Available for shipment Available now
sa6908 Nonsense Mutation detected in F1 DNA During 2016
sa33254 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127483 Nonsense 775 1105 4 13
Genomic Location (Zv9):
Chromosome 3 (position 38717280)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38580640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTTTTAGGTACTTGTCCTACAGTGCCCTGCCCATCACTCAGTGTCTG[T/A]GTGAACTCCGTCTGCCAGTGCTTGGCAGGAACTGTTCTTTTAAATAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127483 Nonsense 933 1105 8 13
Genomic Location (Zv9):
Chromosome 3 (position 38710971)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38574331
KASP Assay ID:
554-5451.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTAATACTAAAGATGGGTCTGCCATCTGTACCTGTGTAACTGGTTA[C/A]ATCCSCAGTCCTTACCAGATCAAAAGCTGCAGTGGTGAGTTTTTATTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127483 Essential Splice Site 945 1105 8 13
Genomic Location (Zv9):
Chromosome 3 (position 38710935)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38574295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTAACTGGTTACATCCCCAGTCCTTACCAGATCAAAAGCTGCAGTGG[T/G]GAGTTTTTATTACTGCATAAAAAAAATCACATGAGCTACCATGTATGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link