LOC571530

Ensembl ID:
ENSDARG00000091813
Human Orthologue:
AC007064.28

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36497 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16597 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125162 Essential Splice Site 70 338 3 9
Genomic Location (Zv9):
Chromosome 17 (position 43570661)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43535336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCTTTGTTGACTTCGGATTTGTAGAATGCTTGTGTCTTTCTGTCCTC[A/T]GAGACTCTGCTGTGTTCTTGCTGTCCTGACGTGGGCATGTGTGTGTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125162 Nonsense 191 338 6 9
Genomic Location (Zv9):
Chromosome 17 (position 43569314)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43533989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGATCTGTCCTGCCGGAKCAGAGGCTTTGCAAACCGCTTCCAAAGAATG[T/A]ACACTCTGCCGCCCAGGTATCTTAACACAGTTTTAGTGATKGTATGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link