ENSDARG00000091806

Ensembl ID:
ENSDARG00000091806

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8970 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129281 Nonsense 281 288 6 6
Genomic Location (Zv9):
Chromosome 11 (position 135117)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 67612
KASP Assay ID:
2260-3740.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAGTCGCTGTCTGGCACGATGCGCCTCCGGATCAAAGGTCACCTGT[G/A]GAACAGCAGCTTCATCGAGGTCAGACTCTACTTCAGTCCTCATWACCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link