ENSDARG00000091806

Ensembl ID:
ENSDARG00000091806

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18997 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8970 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129281 Essential Splice Site 91 288 1 6
Genomic Location:
Chromosome 11 (position 136481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATCAGCATCCACACCACCTCTCTAAGCGTGCAGCTGACTCTGTCCAC[G/A]TGAGTGTGTTTCTGCTCCAGACCTGCGGGGGTGATGGAGAGCAGATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129281 Nonsense 281 288 6 6
Genomic Location:
Chromosome 11 (position 135117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAGTCGCTGTCTGGCACGATGCGCCTCCGGATCAAAGGTCACCTGT[G/A]GAACAGCAGCTTCATCGAGGTCAGACTCTACTTCAGTCCTCATWACCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y4dbf9e9