ENSDARG00000091803

Ensembl ID:
ENSDARG00000091803
Human Orthologue:
AC092718.1
Mouse Orthologues:
Pkd1l2, Pkd1l3
Mouse Descriptions:
polycystic kidney disease 1 like 2 Gene [Source:MGI Symbol;Acc:MGI:2664668]
polycystic kidney disease 1 like 3 Gene [Source:MGI Symbol;Acc:MGI:2664670]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18895 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124378 Nonsense 986 1083 19 21
Genomic Location:
Chromosome 7 (position 57756086)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTAGTTCAAGTACAGAAGAAGAAGCAGGGCTGGTGGTTGCCCTGGTG[G/A]TTTCTGTTCATCGGCTGGTTTCTGCTTTTTGTCATGAGTGGTATTTCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a27yabda