serpinb1l4

Ensembl ID:
ENSDARG00000091801
ZFIN IDs:
ZDB-GENE-030131-7169, ZDB-GENE-040715-5
Description:
serpin peptidase inhibitor, clade B (ovalbumin), member 1, like 4 [Source:RefSeq peptide;Acc:NP_956
Human Orthologues:
SERPINB10, SERPINB12, SERPINB13, SERPINB2, SERPINB3, SERPINB4, SERPINB7
Human Descriptions:
serpin peptidase inhibitor, clade B (ovalbumin), member 10 [Source:HGNC Symbol;Acc:8942]
serpin peptidase inhibitor, clade B (ovalbumin), member 12 [Source:HGNC Symbol;Acc:14220]
serpin peptidase inhibitor, clade B (ovalbumin), member 13 [Source:HGNC Symbol;Acc:8944]
serpin peptidase inhibitor, clade B (ovalbumin), member 2 [Source:HGNC Symbol;Acc:8584]
serpin peptidase inhibitor, clade B (ovalbumin), member 3 [Source:HGNC Symbol;Acc:10569]
serpin peptidase inhibitor, clade B (ovalbumin), member 4 [Source:HGNC Symbol;Acc:10570]
serpin peptidase inhibitor, clade B (ovalbumin), member 7 [Source:HGNC Symbol;Acc:13902]
Mouse Orthologues:
Serpinb11, Serpinb12, Serpinb13, Serpinb2, Serpinb3a, Serpinb3b, Serpinb3c, Serpinb3d, Serpinb7
Mouse Descriptions:
serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 11 Gene [Source:MGI Symbol;Acc
serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 12 Gene [Source:MGI Symbol;Acc
serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13 Gene [Source:MGI Symbol;Acc
serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A Gene [Source:MGI Symbol;Acc
serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3B Gene [Source:MGI Symbol;Acc
serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D Gene [Source:MGI Symbol;Acc
serine (or cysteine) peptidase inhibitor, clade B, member 2 Gene [Source:MGI Symbol;Acc:MGI:97609]
serine (or cysteine) peptidase inhibitor, clade B, member 3C Gene [Source:MGI Symbol;Acc:MGI:1277952
serine (or cysteine) peptidase inhibitor, clade B, member 7 Gene [Source:MGI Symbol;Acc:MGI:2151053]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42827 Nonsense Mutation detected in F1 DNA During 2017
sa39129 Nonsense Mutation detected in F1 DNA During 2017
sa16682 Nonsense Available for shipment Available now
sa15106 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046420   None 384 None 7
ENSDART00000050644   None 456 None 7
ENSDART00000079846 Nonsense 211 393 7 8
Genomic Location (Zv9):
Chromosome 16 (position 54850183)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 51432120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGAAATGAGAGTCATAAAATGTCATTGATGCTTTGCAGAATCAAACT[A/T]AACCAGTGAAGATGATGCACCAGAAAGCTCAATTTCCATTTGTCGTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046420 Nonsense 30 384 2 7
ENSDART00000050644   None 456 None 7
ENSDART00000079846   None 393 None 8
Genomic Location (Zv9):
Chromosome 16 (position 54874919)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 51407384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTGTTCAAGAAGATCAGCGGAGGAAACGCATCAGGAAATGTGTTTTA[T/A]TCTCCTGTCAGCATCTCCTCGGCTCTGGCCATGGTGTCGCTCGGTGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046420 Nonsense 257 384 7 7
ENSDART00000050644   None 456 None 7
ENSDART00000079846   None 393 None 8
Genomic Location (Zv9):
Chromosome 16 (position 54879282)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 51403021
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGCTCACATGACTCTCTTATCCTCCAGCTTGAGARGGCACTGACCTA[T/A]GAGAAGCTCWTGGAGTGGACCAAACCRGAAGTGATGCRTCAACRGGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046420   None 384 None 7
ENSDART00000050644 Nonsense 354 456 7 7
ENSDART00000079846   None 393 None 8
Genomic Location (Zv9):
Chromosome 16 (position 54901443)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 51380860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCGGAWGTGATGCRTCAACAGGAGRTTCAAGTCTCTCTGCCTAAATTC[A/T]AGATGGAGCAAACCTAYGACATGAAGAGTCTTCTGGTCAGCATGGGGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link