LOC100001721

Ensembl ID:
ENSDARG00000091792
Human Orthologue:
AKAP12
Human Description:
A kinase (PRKA) anchor protein 12 [Source:HGNC Symbol;Acc:370]
Mouse Orthologue:
Akap12
Mouse Description:
A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28800 Nonsense Mutation detected in F1 DNA During 2016
sa32118 Nonsense Available for shipment Available now
sa17436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128341 Nonsense 296 3023 3 3
Genomic Location (Zv9):
Chromosome 17 (position 7613947)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7616721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAACTCAAAGAAAACGAGAAGACAATTGCTGAAGAGGAGGCTGAAAAA[C/T]AGGACAGTAAATGCATGTGCCTTGACATCCCTTATATTATATCAGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128341 Nonsense 1426 3023 3 3
Genomic Location (Zv9):
Chromosome 17 (position 7617337)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7620111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGACAAATAATAAAGATGAAATACTAGCGGTGACAGAAGTAATTCCC[A/T]AAGAACAGGTGCCACCACTGAGGTCTGAAGTGACAGCAGAAATGCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128341 Nonsense 2106 3023 3 3
Genomic Location (Zv9):
Chromosome 17 (position 7619377)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7622151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCAACTCCTGTTTCAGTGCTTGATGCACCAGCTGTAACCCCAGTGGTT[C/T]AAACACCAGGCCAGGGTTCAGCCAGKGTAATAGAGACTTYACCTTTACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link