lysmd2

Ensembl ID:
ENSDARG00000091771
ZFIN ID:
ZDB-GENE-040801-250
Description:
LysM and putative peptidoglycan-binding domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc
Human Orthologue:
LYSMD2
Human Description:
LysM, putative peptidoglycan-binding, domain containing 2 [Source:HGNC Symbol;Acc:28571]
Mouse Orthologue:
Lysmd2
Mouse Description:
LysM, putative peptidoglycan-binding, domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917332]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6530 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127955 Nonsense 22 208 1 3
Genomic Location:
Chromosome 18 (position 37854052)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCGGTGCTGCCTCCGTTGCGGGATGATGGAGGAGGGGGACGGTATGGA[C/T]AGCCGCTATTCCCCAGATCCCGGTCCGGTTCGGAGTCMGACAGTGAATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hm1hj511