LOC100333630

Ensembl ID:
ENSDARG00000091766
Human Orthologue:
ARHGEF17
Human Description:
Rho guanine nucleotide exchange factor (GEF) 17 [Source:HGNC Symbol;Acc:21726]
Mouse Orthologue:
Arhgef17
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 17 Gene [Source:MGI Symbol;Acc:MGI:2673002]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13368 Nonsense Available for shipment Available now
sa12689 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121713 Nonsense 13 1327 1 2
Genomic Location:
Chromosome 18 (position 2726463)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGCATCGCGATGGCTGAAAGGGAGACTGAGAGAAAAGCGCCTGTATA[T/G]AGAAGCGTCTCTTTTAAAAAGTTGGAGAGCTGGAGCGCCAAGAAGCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121713 Nonsense 745 1327 2 2
Genomic Location:
Chromosome 18 (position 2729140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCTTATGGATACGATGAGCCAATGCCRACACCTTTACAAGACCGTTA[T/A]TTGCAGGAAGCCAGACAGGTAATAAGAGACATTTGTCAAATGGGTGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vn50eyf6