LOC100333630

Ensembl ID:
ENSDARG00000091766
Human Orthologue:
ARHGEF17
Human Description:
Rho guanine nucleotide exchange factor (GEF) 17 [Source:HGNC Symbol;Acc:21726]
Mouse Orthologue:
Arhgef17
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 17 Gene [Source:MGI Symbol;Acc:MGI:2673002]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13368 Nonsense Available for shipment Available now
sa12689 Nonsense Available for shipment Available now
sa28957 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa13368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121713 Nonsense 13 1327 1 2
Genomic Location:
Chromosome 18 (position 2726463)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGCATCGCGATGGCTGAAAGGGAGACTGAGAGAAAAGCGCCTGTATA[T/G]AGAAGCGTCTCTTTTAAAAAGTTGGAGAGCTGGAGCGCCAAGAAGCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121713 Nonsense 745 1327 2 2
Genomic Location:
Chromosome 18 (position 2729140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCTTATGGATACGATGAGCCAATGCCRACACCTTTACAAGACCGTTA[T/A]TTGCAGGAAGCCAGACAGGTAATAAGAGACATTTGTCAAATGGGTGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121713 Nonsense 1116 1327 2 2
Genomic Location:
Chromosome 18 (position 2730251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCATCTTATCAGAGCAAAGAGATGAGTTGTGGGCGCTAAATAGTGAA[C/T]AACGACAGCATTACTGTTCACCCAGAAGGTCTCGTTCACAGTCTGAGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vn50eyf6