PLA2G4C (4 of 5)

Ensembl ID:
ENSDARG00000091765
Description:
phospholipase A2, group IVC (cytosolic, calcium-independent) [Source:HGNC Symbol;Acc:9037]
Human Orthologue:
PLA2G4C
Human Description:
phospholipase A2, group IVC (cytosolic, calcium-independent) [Source:HGNC Symbol;Acc:9037]
Mouse Orthologue:
Pla2g4c
Mouse Description:
phospholipase A2, group IVC (cytosolic, calcium-independent) Gene [Source:MGI Symbol;Acc:MGI:1196403

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33519 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127077 Essential Splice Site 403 591 10 14
Genomic Location (Zv9):
Chromosome 5 (position 2052069)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 1677416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGAACTCTGCAACTTTCTGACGGATCAGTTCAATTTATGGCCATTTG[G/A]TAAGTTGAACGGTCTCTAATATTGATGTATCGATTCTTTACGTGCTCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link