si:ch211-227e10.6

Ensembl ID:
ENSDARG00000091764
ZFIN ID:
ZDB-GENE-050420-355
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KQD8]
Human Orthologue:
NLRX1
Human Description:
NLR family member X1 [Source:HGNC Symbol;Acc:29890]
Mouse Orthologue:
Nlrx1
Mouse Description:
NLR family member X1 Gene [Source:MGI Symbol;Acc:MGI:2429611]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25285 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122038 Nonsense 4 373 1 6
ENSDART00000132252   None 684 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 45258260)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 52556551
KASP Assay ID:
554-7503.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGCTCTGCTAATGTCTGCATTGGTGTTTAAGCTGCAGTATGGCAGAG[G/T]AGCGAGTAAAGGATTCTCTCTCAGAGAAACACAGGTATTGACTCTGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link