HGFAC

Ensembl ID:
ENSDARG00000091759
Description:
HGF activator [Source:HGNC Symbol;Acc:4894]
Human Orthologue:
HGFAC
Human Description:
HGF activator [Source:HGNC Symbol;Acc:4894]
Mouse Orthologue:
Hgfac
Mouse Description:
hepatocyte growth factor activator Gene [Source:MGI Symbol;Acc:MGI:1859281]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14773 Essential Splice Site Available for shipment Available now
sa21174 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128264 Essential Splice Site 31 145 1 3
ENSDART00000128264 Essential Splice Site 31 145 1 3
Genomic Location:
Chromosome 8 (position 2145903)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGRCGTCCTGCTGGATSGTTTCAGCYGCTCACTGCTTCCTGCGCAAG[T/C]AKGACTGAGCATTTCYATCKATAACGCCTTYATNGTTGGATCACTTYATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128264 Essential Splice Site 31 145 1 3
ENSDART00000128264 Essential Splice Site 31 145 1 3
Genomic Location:
Chromosome 8 (position 2145903)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGCGTCCTGCTGGATCGTTTCAGCCGCTCACTGCTTCCTGCGCAAG[T/A]ATGACTGAGCATTTCTATCGATAACGCCTTCATTGTTGGATCACTTTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/snv8buib