insm1a

Ensembl ID:
ENSDARG00000091756
ZFIN ID:
ZDB-GENE-040426-1810
Description:
insulinoma-associated 1a [Source:RefSeq peptide;Acc:NP_991207]
Human Orthologue:
INSM1
Human Description:
insulinoma-associated 1 [Source:HGNC Symbol;Acc:6090]
Mouse Orthologue:
Insm1
Mouse Description:
insulinoma-associated 1 Gene [Source:MGI Symbol;Acc:MGI:1859980]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa195 Nonsense Confirmed mutation in F2 line During 2017
sa43534 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa195
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124040 Nonsense 141 383 1 2
Genomic Location (Zv9):
Chromosome 20 (position 48788645)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48677291
KASP Assay ID:
554-0148.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAGAGCGCAAAGGCAAACCGGCATCCAAGAAAGCCAAAGCCATGCGG[A/T]AGCTGCAGTTCGAGGATGAGATGACCACCTCTCCAGTGCTCGGACTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124040 Nonsense 143 383 1 2
Genomic Location (Zv9):
Chromosome 20 (position 48788639)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48677285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCAAAGGCAAACCGGCATCCAAGAAAGCCAAAGCCATGCGGAAGCTG[C/T]AGTTCGAGGATGAGATGACCACCTCTCCAGTGCTCGGACTGAAGATCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link