LOC560088

Ensembl ID:
ENSDARG00000091723
Human Orthologues:
CAPN13, CAPN14
Human Descriptions:
calpain 13 [Source:HGNC Symbol;Acc:16663]
calpain 14 [Source:HGNC Symbol;Acc:16664]
Mouse Orthologue:
Capn13
Mouse Description:
calpain 13 Gene [Source:MGI Symbol;Acc:MGI:2685789]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43000 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122583 Essential Splice Site 386 523 9 13
Genomic Location (Zv9):
Chromosome 17 (position 45782224)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45631456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATACTTTCATACACCACCTTACAGCTGGTGGTGACATCATTAAGACAG[G/A]TACTATTATTCAGTGCAAACACATGCGGTTTTGTATAAAGCGCTAACATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link