LOC100333645

Ensembl ID:
ENSDARG00000091715
Human Orthologues:
MUC17, MUC5B
Human Descriptions:
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40817 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126322 Essential Splice Site 25 3825 3 18
Genomic Location (Zv9):
Chromosome 7 (position 905067)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 787666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGAAAATTTATCTGTAATGTACATTGCTTTGATTTTTTTTAAATGAC[A/T]GCATTCACAATTACATCTATAACTGGACAAACAACAATTGATAATAATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link