Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC100333645
- Ensembl ID:
- ENSDARG00000091715
- Human Orthologues:
- MUC17, MUC5B
- Human Descriptions:
- mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
- mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa40817 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40817
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000126322 | Essential Splice Site | 25 | 3825 | 3 | 18 |
- Genomic Location (Zv9):
- Chromosome 7 (position 905067)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 787666 GRCz11 7 942544 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATATGAAAATTTATCTGTAATGTACATTGCTTTGATTTTTTTTAAATGAC[A/T]GCATTCACAATTACATCTATAACTGGACAAACAACAATTGATAATAATAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
