fkrp

Ensembl ID:
ENSDARG00000091714
ZFIN ID:
ZDB-GENE-070412-4
Description:
fukutin related protein (fkrp), transcript variant 2, mRNA [Source:RefSeq DNA;Acc:NM_001042689]
Human Orthologue:
FKRP
Human Description:
fukutin related protein [Source:HGNC Symbol;Acc:17997]
Mouse Orthologue:
Fkrp
Mouse Description:
fukutin related protein Gene [Source:MGI Symbol;Acc:MGI:2447586]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa295 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa295
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130763 Nonsense 169 536 1 1
ENSDART00000145130 Nonsense 169 536 2 2
Genomic Location:
Chromosome 15 (position 12147414)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAGAGTTTTCTTTGTTAGTTCCTGATGGTGTGGAGCTGGACCATGGT[C/T]GACAAGTTGAGCGTCTCATTCGGGAGCTGGAAGGGGAAGGTGGTGGGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cvxsw9xv