DIAPH2 (1 of 2)

Ensembl ID:
ENSDARG00000091673
Description:
diaphanous homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:2877]
Human Orthologue:
DIAPH2
Human Description:
diaphanous homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:2877]
Mouse Orthologue:
Diap2
Mouse Description:
diaphanous homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1858500]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13321 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129865 Nonsense 63 169 3 4
Genomic Location (Zv9):
Chromosome 14 (position 38446799)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 39272535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTGTTTGTGCATTTTCTTTACAGAACCTGATCAAAAACCTTCCTGAG[C/T]AGAAAGAACTGAGCAATCTGGCCRAACTGAAGAATGAATATGAGGAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link