si:dkey-17e16.17

Ensembl ID:
ENSDARG00000091669
ZFIN ID:
ZDB-GENE-091204-161

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37319 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa11163 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125709 Splice Site, Nonsense 218 382 4 6

The following transcripts of ENSDARG00000091669 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 25072932)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25656269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGGAAACAAAATGTGCTATTTAAGTTAAAATTCACTTCCTTTGACAG[G/T]GAAAGGAGAAGTCTGGAGAAGACGCTGCCATTTTACAGCAAGCTCTACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125709 Nonsense 349 382 6 6

The following transcripts of ENSDARG00000091669 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 25074799)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25658136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACTGTGCCGATTCCTGAGTCCCCGTCACCCACAGCAACACAGAGGTGG[A/T]AAGACAAGTTCAGACGTGGACGGATCACTTCACWAGAACCAGTGGAGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link