NRCAM (2 of 2)

Ensembl ID:
ENSDARG00000091662
Description:
neuronal cell adhesion molecule [Source:HGNC Symbol;Acc:7994]
Human Orthologue:
NRCAM
Human Description:
neuronal cell adhesion molecule [Source:HGNC Symbol;Acc:7994]
Mouse Orthologue:
Nrcam
Mouse Description:
neuron-glia-CAM-related cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:104750]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16577 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125270 Nonsense 221 445 5 13
Genomic Location (Zv9):
Chromosome 25 (position 47176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTACCGGCGCGAGYGCAGTCTGCACYGCCACAACTCTCACCACGCAGAG[C/T]AGCGCAGCAAGACCTTCAGCACCGGCAGCAGCAGCGGACGCCTGACAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link