LPL (1 of 2)

Ensembl ID:
ENSDARG00000091659
Description:
lipoprotein lipase [Source:HGNC Symbol;Acc:6677]
Human Orthologue:
LPL
Human Description:
lipoprotein lipase [Source:HGNC Symbol;Acc:6677]
Mouse Orthologue:
Lpl
Mouse Description:
lipoprotein lipase Gene [Source:MGI Symbol;Acc:MGI:96820]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39502 Nonsense Mutation detected in F1 DNA During 2017
sa30345 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124328 Nonsense 123 530 3 10
Genomic Location (Zv9):
Chromosome Zv9_scaffold3497 (position 33047)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17537013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCTAATGTCATTGTTGTGGACTGGCTGGATCGGGCCAACAAACACTA[C/A]CCCAAATCAGCAGAAAACACCAGGCTAGTGGGGGCCGACGTTGCCAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124328 Nonsense 332 530 6 10
Genomic Location (Zv9):
Chromosome Zv9_scaffold3497 (position 45510)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17549476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATACAACGTCAAGAAGATCCGCAGCACCAGAAGCACCAAGATGTACCTC[A/T]AAACCCGCGAGATGATGCCCTTTAAAGGTAAGGGGGGATATTTTGACTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link