xrn1

Ensembl ID:
ENSDARG00000091652
ZFIN IDs:
ZDB-GENE-040426-1203, ZDB-GENE-040426-1203
Description:
5'-3' exoribonuclease 1 [Source:RefSeq peptide;Acc:NP_957327]
Human Orthologue:
XRN1
Human Description:
5'-3' exoribonuclease 1 [Source:HGNC Symbol;Acc:30654]
Mouse Orthologue:
Xrn1
Mouse Description:
5'-3' exoribonuclease 1 Gene [Source:MGI Symbol;Acc:MGI:891964]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31269 Nonsense Mutation detected in F1 DNA During 2016
sa19713 Nonsense Mutation detected in F1 DNA During 2016
sa19714 Nonsense Mutation detected in F1 DNA During 2016
sa32872 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32873 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6008 Nonsense Mutation detected in F1 DNA During 2016
sa32874 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39802 Nonsense Mutation detected in F1 DNA During 2016
sa19715 Nonsense Mutation detected in F1 DNA During 2016
sa19716 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772   None 504 1 18
ENSDART00000125413 Nonsense 7 1697 1 42
Genomic Location (Zv9):
Chromosome 2 (position 16417717)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16928544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTTTTATTTGAAGACTTACACGAGACGATGGGAGTGCCTAAGTTTTA[T/A]CGATGGATATCAGAGCGGTATCCGTGTCTGAGTGAAGTTGTCAAAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772   None 504 None 18
ENSDART00000125413 Nonsense 67 1697 2 42
Genomic Location (Zv9):
Chromosome 2 (position 16420327)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16931154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCACTTCCGTATTTCTGAAGAGAAGATATTCGCTGACATTTTTCACTA[T/A]CTGGAAGTGCTCTTTCGCATCATTAAGCCAAGGAAAGTGTTCTTCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772 Nonsense 38 504 4 18
ENSDART00000125413 Nonsense 127 1697 3 42
Genomic Location (Zv9):
Chromosome 2 (position 16421250)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16932077
KASP Assay ID:
2259-1799.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAATCAAGAAGGCCTTGGAGAAGGGAGAAGTTTTGCCCACAGAGGCC[C/T]GATTTGACTCTAACTGCATCACTCCGGGTTTGTGTTCATTTATCGCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772   None 504 None 18
ENSDART00000125413 Essential Splice Site 779 1697 20 42
Genomic Location (Zv9):
Chromosome 2 (position 16444259)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16955086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAGAGCAGAAGGACTGGGTCAAAGAAGTGCAAGGCCTCACAGAGCAG[T/A]AAGCTGAAACCTTTATTAACTTTATTTATTCACGTAATTTATTAACAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772   None 504 None 18
ENSDART00000125413 Essential Splice Site 833 1697 21 42
Genomic Location (Zv9):
Chromosome 2 (position 16446454)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16957281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTTTGCCAAGCAGGTCCTGCCCTTTCCATATCAGACCATTGTGAAGG[T/G]AAATATTCGCACCAAAACAAAATATTCATGAATAAACGTCAGCATTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772   None 504 None 18
ENSDART00000125413 Nonsense 1043 1697 27 42
Genomic Location (Zv9):
Chromosome 2 (position 16451964)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16962791
KASP Assay ID:
554-3881.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAAGAGATCCAGGGCTGGWTGAAAACGCATCCAGTGAGCTCCATCTCC[A/T]GAGCATCATGTGATCTGCAGATCCTGGATGCTGGTATTGTGGAGAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772   None 504 None 18
ENSDART00000125413 Essential Splice Site 1067 1697 27 42
Genomic Location (Zv9):
Chromosome 2 (position 16452040)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16962867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGCTGGTATTGTGGAGAAGATTGAGGAGGAGCTGGAGAAAACGAAGG[T/G]GAGGATCACATACAAAAATTGACAATCACAGTTACTGTTGCTGGCATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772   None 504 None 18
ENSDART00000125413 Nonsense 1249 1697 32 42
Genomic Location (Zv9):
Chromosome 2 (position 16456205)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16967032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTCAGGGCAACAGGAACTCGCCACATAAAGCCCTCAACCAGAGAAAC[C/T]AACAAAAGGTATGAAGTGTGAGGTTAATAGGCCTTTTCTGCTGTGGGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772   None 504 None 18
ENSDART00000125413 Nonsense 1488 1697 39 42
Genomic Location (Zv9):
Chromosome 2 (position 16463553)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16974380
KASP Assay ID:
2259-1800.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATATCATTTGCTCTTTTCTCTATGTTCTGCAGAGTCTGATCTTGTG[T/A]CAGGTGAAGTTGTCGAATGGTCTGATGGTTCACGGCCCTCAGTGTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772   None 504 None 18
ENSDART00000125413 Essential Splice Site 1607 1697 41 42
Genomic Location (Zv9):
Chromosome 2 (position 16464644)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16975471
KASP Assay ID:
2259-1801.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGCCATCAGCAGCCGGCGGATCCCATAACCAGTTTGTTCCCCTTCAG[G/A]TAATGATTTGCGTCTAGACATGCACACGGAAATCAGTGGCTGTGTTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link