xrn1

Ensembl ID:
ENSDARG00000091652
ZFIN IDs:
ZDB-GENE-040426-1203, ZDB-GENE-040426-1203
Description:
5'-3' exoribonuclease 1 [Source:RefSeq peptide;Acc:NP_957327]
Human Orthologue:
XRN1
Human Description:
5'-3' exoribonuclease 1 [Source:HGNC Symbol;Acc:30654]
Mouse Orthologue:
Xrn1
Mouse Description:
5'-3' exoribonuclease 1 Gene [Source:MGI Symbol;Acc:MGI:891964]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19713 Nonsense Mutation detected in F1 DNA During 2014
sa19714 Nonsense Mutation detected in F1 DNA During 2014
sa6008 Nonsense Mutation detected in F1 DNA During 2014
sa19715 Nonsense Mutation detected in F1 DNA During 2014
sa19716 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772 None None 504 None 18
ENSDART00000125413 Nonsense 67 1697 2 42
Genomic Location:
Chromosome 2 (position 16420327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCACTTCCGTATTTCTGAAGAGAAGATATTCGCTGACATTTTTCACTA[T/A]CTGGAAGTGCTCTTTCGCATCATTAAGCCAAGGAAAGTGTTCTTCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772 Nonsense 38 504 4 18
ENSDART00000125413 Nonsense 127 1697 3 42
Genomic Location:
Chromosome 2 (position 16421250)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAATCAAGAAGGCCTTGGAGAAGGGAGAAGTTTTGCCCACAGAGGCC[C/T]GATTTGACTCTAACTGCATCACTCCGGGTTTGTGTTCATTTATCGCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772 None None 504 None 18
ENSDART00000125413 Nonsense 1043 1697 27 42
Genomic Location:
Chromosome 2 (position 16451964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAAGAGATCCAGGGCTGGWTGAAAACGCATCCAGTGAGCTCCATCTCC[A/T]GAGCATCATGTGATCTGCAGATCCTGGATGCTGGTATTGTGGAGAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772 None None 504 None 18
ENSDART00000125413 Nonsense 1488 1697 39 42
Genomic Location:
Chromosome 2 (position 16463553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATATCATTTGCTCTTTTCTCTATGTTCTGCAGAGTCTGATCTTGTG[T/A]CAGGTGAAGTTGTCGAATGGTCTGATGGTTCACGGCCCTCAGTGTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121772 None None 504 None 18
ENSDART00000125413 Essential Splice Site 1607 1697 41 42
Genomic Location:
Chromosome 2 (position 16464644)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGCCATCAGCAGCCGGCGGATCCCATAACCAGTTTGTTCCCCTTCAG[G/A]TAATGATTTGCGTCTAGACATGCACACGGAAATCAGTGGCTGTGTTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xflzyh9x