ENSDARG00000091651

Ensembl ID:
ENSDARG00000091651

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40829 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123514 Nonsense 95 181 4 4
Genomic Location (Zv9):
Chromosome 7 (position 6400853)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5435191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCACATCTGACACTGGAGTTTACTGGTGTGAGTCTGAATCTGGAGAG[A/T]AACACCATCCTCTGAACATCATTGTACATGGAGAGATCACAGCATCTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link