LOC568564

Ensembl ID:
ENSDARG00000091633
Human Orthologue:
PLB1
Human Description:
phospholipase B1 [Source:HGNC Symbol;Acc:30041]
Mouse Orthologue:
Plb1
Mouse Description:
phospholipase B1 Gene [Source:MGI Symbol;Acc:MGI:1922406]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16672 Essential Splice Site Available for shipment Available now
sa23718 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125688 Essential Splice Site 383 433 15 16
Genomic Location:
Chromosome 20 (position 27040946)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGTGGAGAGCTTTTCAGACCCTATCGAGCTTGTTTGCCCTCAGGTGG[T/A]AAGAAAAAAACTACTAATAATGTTTTTTCATACAATTAGGACACTTNNNNNNNNTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125688 Nonsense 408 433 16 16
Genomic Location:
Chromosome 20 (position 27041139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCGCTGCAGCGAAGTCCGGCTCATCTCGTCCTGAGTCAGCTGGCATC[A/T]GACTGGCCGTTCTCCACCTTATGCCTCCTTTGGCGCTTCTGCCACTCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e2bq82r3