si:ch211-197h24.6

Ensembl ID:
ENSDARG00000091631
ZFIN ID:
ZDB-GENE-030131-1361

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18094 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127917   None 349 None 12
ENSDART00000133398 Nonsense 229 391 9 12

The following transcripts of ENSDARG00000091631 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 29783199)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27620337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCTGGCATGCGGGGCGGTATGGACAGTCTCCCAATAAGGGGAGGTTA[T/G]TCTAAWATGAGAGAATTCACTAGCCCCAGTCGCTATGGTAATGGTGGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link