LOC100148715

Ensembl ID:
ENSDARG00000091626
Human Orthologues:
LTB4R, LTB4R2
Human Descriptions:
leukotriene B4 receptor 2 [Source:HGNC Symbol;Acc:19260]
leukotriene B4 receptor [Source:HGNC Symbol;Acc:6713]
Mouse Orthologues:
Ltb4r1, Ltb4r2
Mouse Descriptions:
leukotriene B4 receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1309472]
leukotriene B4 receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1888501]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20852 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121414 Nonsense 136 424 1 4
Genomic Location:
Chromosome 7 (position 5966180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTCGCTGATGGCTTCCTCATGCTGCTCACGCCCTTCTTCATGGTGTA[T/A]CTGGTTCAGCGAAGTTGGGTTTTCAGCCTGGCGCTGTGCAAAGTCCTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dzrthhep