CLTCL1 (1 of 2)

Ensembl ID:
ENSDARG00000091618
Description:
clathrin, heavy chain-like 1 [Source:HGNC Symbol;Acc:2093]
Human Orthologue:
CLTCL1
Human Description:
clathrin, heavy chain-like 1 [Source:HGNC Symbol;Acc:2093]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15646 Essential Splice Site Available for shipment Available now
sa14820 Nonsense Available for shipment Available now
sa9021 Nonsense Mutation detected in F1 DNA During 2014
sa21175 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15646
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123804 Essential Splice Site 531 926 10 18
Genomic Location:
Chromosome 8 (position 2208608)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CARAACTGGAGGATTTCATCAACGGTCCAAACAACGCTCACATACAGCAA[G/A]TGTGTAAACTAGGGATGCAGCAGCAAAATAGCCTTAAAGGTCCTGTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123804 Nonsense 699 926 14 18
Genomic Location:
Chromosome 8 (position 2194994)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAACAGGCTCATCTGTGGGCGGAGCTTGTGTTCCWGTATGAKAAATA[T/A]GAGGAATAKGATAATGCCATCCTGACCATGATGAATCACCCCACAGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123804 Nonsense 702 926 14 18
Genomic Location:
Chromosome 8 (position 2194985)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCATCTGTGGGCGGAGCTTGTGTTCCWGTATGATAAATATGAGGAATA[T/G]GATAATGCCATCCTGACCATGATGAATCACCCCACAGACGCCTGGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123804 Nonsense 736 926 15 18
Genomic Location:
Chromosome 8 (position 2192544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTGTGTTGTTTTTGTGTGCTGAAGGTGGCGAATGTGGAGCTGTATTA[T/G]AAATCTCTGCAGTTTTATTTGGACTATAAGCCGCTGCTTCTCAATGATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/clbpdaqn