prok2

Ensembl ID:
ENSDARG00000091616
ZFIN ID:
ZDB-GENE-100726-1
Description:
prokineticin 2 [Source:RefSeq peptide;Acc:NP_001165870]
Human Orthologue:
PROK2
Human Description:
prokineticin 2 [Source:HGNC Symbol;Acc:18455]
Mouse Orthologue:
Prok2
Mouse Description:
prokineticin 2 Gene [Source:MGI Symbol;Acc:MGI:1354178]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12963 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123341 Essential Splice Site 25 107 2 3
Genomic Location (Zv9):
Chromosome 6 (position 43850589)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 43921753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAAAGTGGACATGTTGATGTGTTTATAATGAGTGCRTGTGTGWTTGC[A/T]GGCATGTGAGAAGGACTCYCAGTGCGGAGGTGGCATGTGTTGTGCAGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link