LYL1

Ensembl ID:
ENSDARG00000091603
Description:
lymphoblastic leukemia derived sequence 1 [Source:HGNC Symbol;Acc:6734]
Human Orthologue:
LYL1
Human Description:
lymphoblastic leukemia derived sequence 1 [Source:HGNC Symbol;Acc:6734]
Mouse Orthologue:
Lyl1
Mouse Description:
lymphoblastomic leukemia 1 Gene [Source:MGI Symbol;Acc:MGI:96891]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44628 Nonsense Mutation detected in F1 DNA During 2017
sa10760 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127734 Nonsense 203 331 4 4
Genomic Location (Zv9):
Chromosome 6 (position 104739)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATAGTGTGTTGATTTGTGCGTGTGGTTCTCCTTCAGGTCCTCCTCAG[A/T]AGCTGGCTCGGCGTGTCTTCACCAACAGCCGCGAGCGCTGGCGGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127734 Nonsense 230 331 4 4
Genomic Location (Zv9):
Chromosome 6 (position 104820)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 151879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYGAGCGCTGGCGGCAGCAGAACGTGAACGGCGCKTTCTCTGAGCTGCGC[A/T]AACTGATCCCGACRCACCCGCCGGACCGMAAGCTGAGCAAGAACGAGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link