ENSDARG00000091592

Ensembl ID:
ENSDARG00000091592
Human Orthologue:
PELI3
Human Description:
pellino homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:30010]
Mouse Orthologue:
Peli3
Mouse Description:
pellino 3 Gene [Source:MGI Symbol;Acc:MGI:1924963]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13258 Essential Splice Site Available for shipment Available now
sa39710 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125878 Essential Splice Site 227 442 5 6
Genomic Location (Zv9):
Chromosome 1 (position 55594478)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54377499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRTCTTCACGCTCAGAGAGACGCGCTCYGCYCAGAAACGTGGCAAACTGG[T/C]GAGAGCACATATTRGATTAAGTGAGAAAYAACTGACRAAAACCCRTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125878 Nonsense 327 442 6 6
Genomic Location (Zv9):
Chromosome 1 (position 55588585)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54371606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGACACGTGCACGGATACCACGCCTGGAGGGGGCGCCGGCGGGTCAGC[A/T]AACACGGCTCCACCGAGGAGGAGGAGGAGAACGAGGACCAGATGGAGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link