ENSDARG00000091585

Ensembl ID:
ENSDARG00000091585
Human Orthologue:
RP11-439E19.8
Human Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B7ZC32]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10417 Nonsense Available for shipment Available now
sa19165 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123256 Nonsense 175 339 4 8
ENSDART00000123256 Nonsense 175 339 4 8
Genomic Location:
Chromosome 17 (position 12049377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCKTCAGAGCTGCTTGGCAAACGGCTGGACTTTCAGCTGGTTTTGGAT[C/T]AGTGCTGTGGATTACGCTGGGTTAAAGAGGCTCGGAACAGAGGCGTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123256 Nonsense 175 339 4 8
ENSDART00000123256 Nonsense 175 339 4 8
Genomic Location:
Chromosome 17 (position 12049377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTTCAGAGCTGCTTGGCAAACGGCTGGACTTTCAGCTGGTTTTGGAT[C/T]AGTGCTGTGGATTACGCTGGGTTAAAGAGGCTCGGAACAGAGGCGTGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cl2ivkoo