ENSDARG00000091580

Ensembl ID:
ENSDARG00000091580
Human Orthologue:
EPHA3
Human Description:
EPH receptor A3 [Source:HGNC Symbol;Acc:3387]
Mouse Orthologue:
Epha3
Mouse Description:
Eph receptor A3 Gene [Source:MGI Symbol;Acc:MGI:99612]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31558 Nonsense Mutation detected in F1 DNA During 2017
sa26918 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126651 Nonsense 96 267 2 3
Genomic Location (Zv9):
Chromosome 7 (position 19323989)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17825372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACCAGCAGCCTCTTTACATCTTTGTTATTAAATCTAACCAGTCTCAG[A/T]AGCCATATGGACCACAAAAACCAGTTCTTGCAATCACAGTCCAGCATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126651 Nonsense 98 267 2 3
Genomic Location (Zv9):
Chromosome 7 (position 19323997)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17825380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCTCTTTACATCTTTGTTATTAAATCTAACCAGTCTCAGAAGCCATA[T/A]GGACCACAAAAACCAGTTCTTGCAATCACAGTCCAGCATCCATTCCTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Orofacial clefts: Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate identify six new risk loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link