ENSDARG00000091573

Ensembl ID:
ENSDARG00000091573
Human Orthologues:
RAP1GAP, RAP1GAP2
Human Descriptions:
RAP1 GTPase activating protein 2 [Source:HGNC Symbol;Acc:29176]
RAP1 GTPase activating protein [Source:HGNC Symbol;Acc:9858]
Mouse Orthologues:
Rap1gap, Rap1gap2
Mouse Descriptions:
RAP1 GTPase activating protein 2 Gene [Source:MGI Symbol;Acc:MGI:3028623]
Rap1 GTPase-activating protein Gene [Source:MGI Symbol;Acc:MGI:109338]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7797 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125411 Essential Splice Site 357 453 12 15
Genomic Location:
Chromosome 16 (position 34149041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGCCCCCATTTGGCCCACCCCTTCCCACACCACCCATTTTTACAGAG[G/A]TAAAAACAAATGACAGAGTGCTTTAGATTTCTGTAAGATAGTTTTTACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/py6qlh30