ENSDARG00000091573

Ensembl ID:
ENSDARG00000091573
Human Orthologues:
RAP1GAP, RAP1GAP2
Human Descriptions:
RAP1 GTPase activating protein 2 [Source:HGNC Symbol;Acc:29176]
RAP1 GTPase activating protein [Source:HGNC Symbol;Acc:9858]
Mouse Orthologues:
Rap1gap, Rap1gap2
Mouse Descriptions:
RAP1 GTPase activating protein 2 Gene [Source:MGI Symbol;Acc:MGI:3028623]
Rap1 GTPase-activating protein Gene [Source:MGI Symbol;Acc:MGI:109338]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36183 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7797 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125411 Essential Splice Site 100 453 4 15
Genomic Location:
Chromosome 16 (position 34152553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATAGTGGAAAATAAATTACTTGCATGCATTTCTTTACTCTTTTACTGC[A/G]GTATCATCATTCATTCACCGCCTGTGACCCTGCTCTTGGGCCTCTAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125411 Essential Splice Site 357 453 12 15
Genomic Location:
Chromosome 16 (position 34149041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGCCCCCATTTGGCCCACCCCTTCCCACACCACCCATTTTTACAGAG[G/A]TAAAAACAAATGACAGAGTGCTTTAGATTTCTGTAAGATAGTTTTTACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link