ENSDARG00000091572

Ensembl ID:
ENSDARG00000091572
Human Orthologue:
AC118759.1
Human Description:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NP22]
Mouse Orthologues:
BC051076, Prol1
Mouse Descriptions:
cDNA sequence BC051076 Gene [Source:MGI Symbol;Acc:MGI:2670982]
proline rich, lacrimal 1 Gene [Source:MGI Symbol;Acc:MGI:107496]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36236 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124125 Nonsense 129 459 4 7
Genomic Location (Zv9):
Chromosome 16 (position 45823147)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43081337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAAAACAAATCATTTTCTAATCTTACGAGTGCTTCTCTTGCAGTAAC[G/T]GATCTGTGATCGCCACTTCTCGACTGCTGTTTGGGCCAACGCACGTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link