ENSDARG00000091570

Ensembl ID:
ENSDARG00000091570

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12983 Nonsense Available for shipment Available now
sa9439 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125929 Nonsense 103 748 2 9
Genomic Location:
Chromosome 24 (position 41280126)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTACCAGAACTGGTATCCCGGCCATCCCGTGCCKAACACAGAAAAAAAA[C/T]AGCCAATCTGCCCAACCACACAAACTCCACTCACCTCCACAACCACAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125929 Nonsense 649 748 7 9
Genomic Location:
Chromosome 24 (position 41294896)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ASGATTAATTATACAGTCAAGTATCATACGCCTTTTTGGAATGAAGATTA[T/A]ACATTAAATACCAGTGACACACATCTTACCTTTCCTAATTTAAGAAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wfpcrd7r