ENSDARG00000091548

Ensembl ID:
ENSDARG00000091548

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11459 Essential Splice Site Available for shipment Available now
sa16123 Nonsense Available for shipment Available now
sa16149 Nonsense Available for shipment Available now
sa14840 Nonsense Mutation detected in F1 DNA During 2014
sa5903 Nonsense Mutation detected in F1 DNA During 2014
sa15359 Nonsense Available for shipment Available now
sa23141 Nonsense Mutation detected in F1 DNA During 2014
sa16538 Nonsense Available for shipment Available now
sa12181 Nonsense Available for shipment Available now
sa23142 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Essential Splice Site 132 3594 5 32
Genomic Location:
Chromosome 17 (position 38678436)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTTTGSCTTCTCAGGACTCCATTGGCCTGACACCAAGGATCTGTCAA[G/A]TAAGTCAAAACTGAAAATGGAATCARCATGTTCGCTCCTTCAYGTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 201 3594 8 32
Genomic Location:
Chromosome 17 (position 38682802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTGTGTTTATGTTAGGTCTTTCTCAGCATGTCGTGACTGACTACAAA[C/T]AAGCAGTGGATCTGTTGGAGGAGGGTATYGCTAACCGCATCACAGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 760 3594 21 32
Genomic Location:
Chromosome 17 (position 38703507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATCGTGTGCGCCGCAAAAGGTTACATTACCAGCTGGAGAAGATTGCA[C/T]GAAAGCGCCATCTGTTGGAGGCAAAGCGTGAACTGCAGAGGCTGGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 796 3594 21 32
Genomic Location:
Chromosome 17 (position 38703616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGGKTGCAATGAAACCTCATCTCTAGAATTGGCATACTCTTYAAAGT[T/A]AAGGGGACRTCCGATGACTTTAAGAAGGCATTCCTTTTCTGCTGATCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 1269 3594 22 32
Genomic Location:
Chromosome 17 (position 38705171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGATCTGATCGGCAACAAAAATGACTTAGAAAGCCAGAGCTCACCTYG[C/A]TCTGACACCACTCAGGGTGAAAATGCAACACTTGAATCAAAYGACACGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 1685 3594 22 32
Genomic Location:
Chromosome 17 (position 38706417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAACTGGATGAATTCAAGTATGAGACGAAYCMCCATGAATATGATTAC[A/T]AAAGTATGCAGGATRGACAWTGTGAAAGTAGCTGTTCCCAGTTGTTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 1900 3594 22 32
Genomic Location:
Chromosome 17 (position 38707064)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAACCATCAATACATAAAACTTCAGGACTGTTAAATGAACTCAGATG[T/A]TCAGCAAGTGAAAAATTTCTTATGGAGATGTCAACTCCAGTAGAGTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 1911 3594 22 32
Genomic Location:
Chromosome 17 (position 38707096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAAATGAACTCAGATGTTCAGCAAGTGAAAMATTTCTTATGGAGATST[C/A]AACTCCAGTAGAGTCCAGTRAAYRTGACAATCTTCAAGCATCGCTACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 2675 3594 22 32
Genomic Location:
Chromosome 17 (position 38709387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGTGTATCCCAGCTAGATGGTGAGGCCAAGATCTTGAAGAACAATTAT[G/T]AAAGTGAACAGGCCTAYGAMAGGATAAAAAGCATGCCTGATTTACGTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 3395 3594 28 32
Genomic Location:
Chromosome 17 (position 38716103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGAATGTGAAATACTTCATTGGTATGCTTGTCTGTTTTAGGTATATT[T/A]GGCCTCTGGAGGTGATGTGAGGAATCTGCTGGCTGGGAAGGCAGCAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wddg79gr