ENSDARG00000091548

Ensembl ID:
ENSDARG00000091548

Alleles

There are 16 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32167 Essential Splice Site Available for shipment Available now
sa11459 Essential Splice Site Available for shipment Available now
sa16123 Nonsense Available for shipment Available now
sa16149 Nonsense Available for shipment Available now
sa14840 Nonsense Mutation detected in F1 DNA During 2016
sa42980 Nonsense Mutation detected in F1 DNA During 2016
sa5903 Nonsense Mutation detected in F1 DNA During 2016
sa15359 Nonsense Available for shipment Available now
sa36482 Nonsense Mutation detected in F1 DNA During 2016
sa23141 Nonsense Available for shipment Available now
sa16538 Nonsense Available for shipment Available now
sa36483 Nonsense Available for shipment Available now
sa12181 Nonsense Available for shipment Available now
sa28904 Nonsense Mutation detected in F1 DNA During 2016
sa23142 Nonsense Available for shipment Available now
sa36484 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Essential Splice Site 16 3594 1 32
Genomic Location (Zv9):
Chromosome 17 (position 38644082)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38528979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGGCCAACGTGAAAGTCGCGATTCGAGTCCGTCCACTGAACACCAGG[T/C]ACAGCAATCTGTTTTAAATAGCATGAATTAACTGTAAAGATGCATGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Essential Splice Site 132 3594 5 32
Genomic Location (Zv9):
Chromosome 17 (position 38678436)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38563333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTTTGSCTTCTCAGGACTCCATTGGCCTGACACCAAGGATCTGTCAA[G/A]TAAGTCAAAACTGAAAATGGAATCARCATGTTCGCTCCTTCAYGTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 201 3594 8 32
Genomic Location (Zv9):
Chromosome 17 (position 38682802)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38567699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTGTGTTTATGTTAGGTCTTTCTCAGCATGTCGTGACTGACTACAAA[C/T]AAGCAGTGGATCTGTTGGAGGAGGGTATYGCTAACCGCATCACAGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 760 3594 21 32
Genomic Location (Zv9):
Chromosome 17 (position 38703507)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38588404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATCGTGTGCGCCGCAAAAGGTTACATTACCAGCTGGAGAAGATTGCA[C/T]GAAAGCGCCATCTGTTGGAGGCAAAGCGTGAACTGCAGAGGCTGGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 796 3594 21 32
Genomic Location (Zv9):
Chromosome 17 (position 38703616)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38588513
KASP Assay ID:
1641-0504.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGGKTGCAATGAAACCTCATCTCTAGAATTGGCATACTCTTYAAAGT[T/A]AAGGGGACRTCCGATGACTTTAAGAAGGCATTCCTTTTCTGCTGATCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 1171 3594 22 32
Genomic Location (Zv9):
Chromosome 17 (position 38704877)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38589774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAATTGGAGACAAAAATATCCAAAGATGTGCCTGCAGAGGTTTACTG[G/A]AGCTTAAATGGTAGTCAGAAGCTAAAAACTGAGAATGGCCAAGGCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 1269 3594 22 32
Genomic Location (Zv9):
Chromosome 17 (position 38705171)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38590068
KASP Assay ID:
554-3929.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGATCTGATCGGCAACAAAAATGACTTAGAAAGCCAGAGCTCACCTYG[C/A]TCTGACACCACTCAGGGTGAAAATGCAACACTTGAATCAAAYGACACGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 1685 3594 22 32
Genomic Location (Zv9):
Chromosome 17 (position 38706417)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38591314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAACTGGATGAATTCAAGTATGAGACGAAYCMCCATGAATATGATTAC[A/T]AAAGTATGCAGGATRGACAWTGTGAAAGTAGCTGTTCCCAGTTGTTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 1887 3594 22 32
Genomic Location (Zv9):
Chromosome 17 (position 38707024)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38591921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGACTTGGCCAACTTCAAAAGAAATGCACAAATTTTATGAGCAACCAT[C/A]AATACATAAAACTTCAGGACTGTTAAATGAACTCAGATGTTCAGCAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 1900 3594 22 32
Genomic Location (Zv9):
Chromosome 17 (position 38707064)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38591961
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAACCATCAATACATAAAACTTCAGGACTGTTAAATGAACTCAGATG[T/A]TCAGCAAGTGAAAAATTTCTTATGGAGATGTCAACTCCAGTAGAGTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 1911 3594 22 32
Genomic Location (Zv9):
Chromosome 17 (position 38707096)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38591993
KASP Assay ID:
2261-1396.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAAATGAACTCAGATGTTCAGCAAGTGAAAMATTTCTTATGGAGATST[C/A]AACTCCAGTAGAGTCCAGTRAAYRTGACAATCTTCAAGCATCGCTACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 2457 3594 22 32
Genomic Location (Zv9):
Chromosome 17 (position 38708733)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38593630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATAAAGGGCTCTCCAGCACACTGAGTAGTAATGGATATTCTAGAGAT[C/T]AAATTTCTTCTGAACCTTTGCTGAAGGCCACTTCTTTGTCCTCAAGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 2675 3594 22 32
Genomic Location (Zv9):
Chromosome 17 (position 38709387)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38594284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGTGTATCCCAGCTAGATGGTGAGGCCAAGATCTTGAAGAACAATTAT[G/T]AAAGTGAACAGGCCTAYGAMAGGATAAAAAGCATGCCTGATTTACGTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 2772 3594 22 32
Genomic Location (Zv9):
Chromosome 17 (position 38709678)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38594575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATCAGACTTGTACCAGAAATGTAGACCTAAAGAATGGCTTTAGTAAA[C/T]AAGTTATGCTTATGGATCGCGCATGCTCCCCTATCCTAACTCTGAAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 3395 3594 28 32
Genomic Location (Zv9):
Chromosome 17 (position 38716103)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38601000
KASP Assay ID:
2261-1399.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGAATGTGAAATACTTCATTGGTATGCTTGTCTGTTTTAGGTATATT[T/A]GGCCTCTGGAGGTGATGTGAGGAATCTGCTGGCTGGGAAGGCAGCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123298 Nonsense 3480 3594 29 32
Genomic Location (Zv9):
Chromosome 17 (position 38716429)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38601326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACGAGTCTGTTAAATCTGCCTGGACACGACCACTGGATGAAAGCACA[C/T]AACTTGGTAAAACCCAAGATTTTTGATATCATAAAGGGTTTCTGTTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link