C7U137_DANRE

Ensembl ID:
ENSDARG00000091539
Description:
DEP-1b [Source:UniProtKB/TrEMBL;Acc:C7U137]
Human Orthologue:
PTPRJ
Human Description:
protein tyrosine phosphatase, receptor type, J [Source:HGNC Symbol;Acc:9673]
Mouse Orthologue:
Ptprj
Mouse Description:
protein tyrosine phosphatase, receptor type, J Gene [Source:MGI Symbol;Acc:MGI:104574]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24681 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126624 Nonsense 162 317 5 9
ENSDART00000127750 None None 105 None 7
Genomic Location:
Chromosome 25 (position 24013798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAACCACCTCAGAGATAGAACTGGATGACTGGACCATTAGAGACTTC[A/T]GAATTAAAAATGTAAAGCAACACTTCCTGATATTCGTCCTAATGTTGTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9w4cndnt