LOC100331496

Ensembl ID:
ENSDARG00000091538
Human Orthologue:
ZRANB3
Human Description:
zinc finger, RAN-binding domain containing 3 [Source:HGNC Symbol;Acc:25249]
Mouse Orthologue:
Zranb3
Mouse Description:
zinc finger, RAN-binding domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1918362]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37453 Nonsense Mutation detected in F1 DNA During 2016
sa24102 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123574 Nonsense 95 782 3 13
ENSDART00000128056 Nonsense 107 204 3 5
Genomic Location (Zv9):
Chromosome 22 (position 12375330)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12235498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTCATGTGGTATTTGCCGAACTCTACTGGAACCCCGGACACATCAAA[C/T]AAGCAGAGGACAGAGCGCATCGAATAGGGCAAACCGCGACCGTACACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123574 Essential Splice Site 131 782 3 13
ENSDART00000128056 Essential Splice Site 143 204 3 5
Genomic Location (Zv9):
Chromosome 22 (position 12375219)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12235387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCCAAAGGAACATTTGACACCGTCATGTGGGCCATGCTCAACAGAAAG[G/A]TACATCGATTAAAAACAAATCCCTAGCTGCAGTATCCACAGATGCTCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link